Primer Tm Calculator
Calculates the melting temperature (Tm) of a primer.
An example is loaded. Clicking the box clears it.
Results — 2 sequences
| Name | Sequence | Length | GC% | Tm (°C) | Rough (Wallace) | ΔH (kcal/mol) | ΔS (cal/mol·K) | MW | ε₂₆₀ |
|---|---|---|---|---|---|---|---|---|---|
| FWD_GAPDH | ACCACAGTCCATGCCATCAC | 20 | 55.0% | 62.2 | 62 | -154.6 | -414.8 | 5991 | 187,700 |
| REV_GAPDH | TCCACCACCCTGTTGCTGTA | 20 | 55.0% | 63.0 | 62 | -152.2 | -406.6 | 6004 | 176,600 |
These are predicted values. The real melting temperature depends on the sequence, the buffer and how it is measured, so confirm it experimentally when it matters.
SantaLucia (1998) nearest-neighbour parameters with the salt correction from the same paper, applied to ΔS. Mg²⁺ left over after the dNTPs chelate it is folded in as an equivalent monovalent concentration (von Ahsen 2001). The rough (Wallace) column is 2(A+T)+4(G+C), an eyeball figure for short primers — decide from the Tm column.
References
Where the equations in this tool come from. Every entry was checked against its PubMed or DOI record.
- SantaLucia J Jr. (1998) A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proc Natl Acad Sci USA 95(4):1460–1465.doi:10.1073/pnas.95.4.1460The nearest-neighbour parameters and the salt correction — both of the things this tool uses come from this one paper
- von Ahsen N, Wittwer CT, Schütz E. (2001) Oligonucleotide melting temperatures under PCR conditions: nearest-neighbor corrections for Mg2+, deoxynucleotide triphosphate, and dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem 47(11):1956–1961.doi:10.1093/clinchem/47.11.1956The relation that turns Mg²⁺ and dNTP into an equivalent monovalent concentration
- von Ahsen N, Wittwer CT, Schütz E. (2011) Monovalent and divalent salt correction algorithms for Tm prediction — recommendations for Primer3 usage. Brief Bioinform 12(5):514–517.doi:10.1093/bib/bbq081The case for which monovalent and divalent corrections to combine
- Green MR, Sambrook J. (2019) Polymerase Chain Reaction. Cold Spring Harb Protoc 2019(6):pdb.top095109.doi:10.1101/pdb.top095109The four values in the standard PCR preset — 50 mM KCl, 1.5 mM Mg²⁺, 200 µM of each dNTP, 0.1–0.5 µM primer
- Wallace RB, Shaffer J, Murphy RF, Bonner J, Hirose T, Itakura K. (1979) Hybridization of synthetic oligodeoxyribonucleotides to phi chi 174 DNA: the effect of single base pair mismatch. Nucleic Acids Res 6(11):3543–3557.doi:10.1093/nar/6.11.3543The 2(A+T) + 4(G+C) rule behind the rough column
The dinucleotide table behind the ε₂₆₀ column is not listed: its source could not be confirmed against a primary record. The molecular weight is a sum of base weights and needs no citation.
How to use it
- Put one primer per line, or several at once as FASTA. Dropping a file in works too.
- Set the oligo concentration and the salts. Na⁺, Mg²⁺ and dNTP all change the answer, and the defaults are a starting point rather than your buffer.
- Read the table. Every row shows what went into its own figure, so two primers can be compared without wondering which settings each one used.
Worth knowing
- The model is SantaLucia (1998) nearest-neighbour parameters with the salt correction from the same paper, applied to ΔS. Magnesium left over after the dNTPs chelate it is what the correction uses.
- These are predicted values. The real melting temperature depends on the sequence, the buffer and how it is measured, so confirm it experimentally when it matters.
- Characters that are not A, C, G or T are removed and counted rather than silently dropped, because one missing letter changes every position after it.
Questions
The other sequence tools
- DNA Reverse Complement — Reverse, complement, or reverse-complement a nucleotide sequence.
- GC Content Calculator — GC and AT content, skew, and GC along the sequence.
- Multiple Sequence Alignment — Align a family of sequences and read the conserved columns.