Reverse Complement

Sequence

This is a sample. Click the box to start typing and it will clear.

Examples:

24 bp · GC content 54%

OperationReverse complementThe opposite strand read in its own 5'→3' direction. This is the one you want for a reverse primer.ReverseThe same bases back to front. Not a real strand on its own — useful for checking orientation.ComplementEach base swapped for its pairing partner, order untouched. Reads 3'→5'.

AlphabetOutput caseLine width

Detected as DNA.

Result — Reverse complement

ACGGATCCGATGCTAACGGTTAGC

Length: 24 bp
GC content: 54.2%
Base counts: A 6C 6G 7T 5